Rarres2 (NM_001013427) Rat Untagged Clone

CAT#: RN202983

Rarres2 (untagged ORF) - Rat retinoic acid receptor responder (tazarotene induced) 2 (Rarres2), (10 ug)


  "NM_001013427" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rarres2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Rarres2
Synonyms MGC108804
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202983 representing NM_001013427
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTGCCTGCTGATCTCCCTGGCCCTATGGCTGGGCACAGCGGACATACACGGGACAGAGCTTGAGC
TCAGCGAGACACAGCGCAGAGGCCTGCAGGTGGCTCTGGAGGAGTTCCACAGACACCCGCCTGTGCAGTG
GGCCTTCCAGGAGATCGGTGTGGACAGTGCTGATGACCTGTTCTTCTCAGCTGGCACCTTTGTGAGGCTG
GAATTTAAGCTCCAGCAGACCAGCTGCCTGAAGAAGGACTGGAAAAAGCCAGAGTGTACAATCAAACCAA
ATGGGAGGAAGCGGAAATGCCTGGCCTGCATCAAACTGGACCCCAAGGGTAAAGTTCTAGGCCGGATGGT
CCACTGCCCAATACTGAAGCAAGGGCCTCAGCAGGAGCCTCAGGAATCCCAGTGCAGTAAGATAGCACAG
GCCGGCGAGGACTCCCGCATCTACTTCTTCCCTGGGCAGTTTGCCTTCTCCAGGGCTCTACAATCCAAAT
AA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001013427
Insert Size 492 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001013427.1, NP_001013445.1
RefSeq Size 765 bp
RefSeq ORF 492 bp
Locus ID 297073
Cytogenetics 4q24

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.