Spink1 (NM_152936) Rat Untagged Clone

CAT#: RN203123

Spink1 (untagged ORF) - Rat serine peptidase inhibitor, Kazal type 1 (Spink1), (10 ug)


  "NM_152936" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Spink1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Spink1
Synonyms Psti; Spink1l; Spink3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203123 representing NM_152936
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGTAGCAATTATCTTTCTTCTCAGTGCTTTGGCCCTGCTCAATTTAGCAGGTAACACTACAGCTA
AGGTGATTGGGAAAAAGGCTAATTGCCCTAATACACTTATTGGATGCCCCAGGGATTATGATCCTGTGTG
TGGTACTGACGGAAAAACTTACGCCAATGAATGCATTCTATGCTTTGAAAACAGGAAATTTGGAACATCT
ATCCGCATTCAGAGGAGAGGGCTTTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_152936
ORF Size 240 bp
Insert Size 240
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_152936.1, NP_690919.1
RefSeq Size 379
RefSeq ORF 240
Locus ID 266602
Gene Summary pancreatic secretory trypsin inhibitor [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.