S100a4 (NM_012618) Rat Untagged Clone

CAT#: RN203138

S100a4 (untagged ORF) - Rat S100 calcium-binding protein A4 (S100a4), (10 ug)


  "NM_012618" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "S100a4"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol S100a4
Synonyms 18A2; 42A; CAPL; MTS1; P9ka; PEL98; RNP9KA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203138 representing NM_012618
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGAGACCCTTGGAGGAGGCCCTGGATGTAATAGTGTCCACCTTCCACAAATACTCAGGCAACGAGG
GTGACAAGTTCAAGCTGAACAAGACAGAGCTCAAGGAGCTACTGACCAGGGAGCTGCCTAGCTTCCTGGG
GAGAAGGACAGACGAAGCTGCATTCCAGAAGCTGATGAACAACTTGGACAGCAACAGGGACAATGAAGTT
GACTTCCAGGAGTACTGTGTCTTCCTGTCCTGCATTGCCATGATGTGCAATGAATTCTTTGAGGGCTGCC
CAGATAAGGAGCCCCGGAAGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012618
ORF Size 306 bp
Insert Size 306
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_012618.2, NP_036750.1
RefSeq Size 486
RefSeq ORF 306
Locus ID 24615
Gene Summary may play a role in regulation of cell growth and differentiation [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.