Rps27a (NM_031113) Rat Untagged Clone

CAT#: RN203186

Rps27a (untagged ORF) - Rat ribosomal protein S27a (Rps27a), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Rps27a
• Synonyms: Uba52; Ubb
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN203186 representing NM_031113
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGATTTTTGTGAAGACCCTTACAGGGAAGACCATCACGCTCGAGGTTGAACCCTCGGACACTATAG
  AAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGGTTGATCTTTGCTGG
  TAAGCAGTTGGAAGATGGCCGTACTTTGTCTGACTACAACATTCAAAAGGAGTCCACTCTCCATCTCGTG
  CTGAGACTTCGTGGTGGCGCTAAGAAAAGGAAGAAGAAGTCTTACACCACCCCAAAGAAGAACAAGCATA
  AGAGAAAGAAGGTCAAGTTGGCTGTGCTGAAATACTATAAGGTGGATGAAAATGGCAAAATCAGCCGACT
  TCGTCGGGAATGTCCTTCTGATGAATGTGGTGCTGGAGTTTTCATGGGTAGCCACTTTGACAGGCATTAC
  TGTGGCAAGTGTTGTCTGACTTACTGCTTCAACAAACCAGAAGACAAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_031113
• ORF Size: 471 bp
• Insert Size: 471
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_031113.2, NP_112375.1
• RefSeq Size: 996
• RefSeq ORF: 471
• Locus ID: 100912032
• Gene Summary: The protein encoded by this gene is a fusion protein that contains ubiquitin at its N-terminus and ribosomal protein S27a at its C-terminus. When the human ortholog of this protein is expressed in yeast, it is processed post-translationally into two products, a free ubiquitin monomer and ribosomal protein S27a, a component of the 40S ribosomal subunit. There are multiple pseudogenes of this gene. There is a locus on chromosome 5 (GeneID:81777) that contains an intact copy of the open reading frame of this gene, that is likely to be the result of retrotransposition of an mRNA into the genome. The transcriptional status of this locus cannot be verified at the present time. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
  Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.