Defb22 (NM_134391) Rat Untagged Clone

CAT#: RN204049

Defb22 (untagged ORF) - Rat defensin beta 22 (Defb22), (10 ug)


  "NM_134391" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Defb22"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Defb22
Synonyms 2D6glycoprotein
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204049 representing NM_134391
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTCCCTATTGTCTGCTCTTATGATCATTATGTTCCTGGCCCACTTGGTCACAGGTAACTGGTACG
TTCGAAAGTGTGCAAACAAATTGGGCACCTGTAGGAAGACGTGCAGAAAAGGGGAGTACCAGACAGACCC
TGCAACGGGGAAATGCTCCATAGGAAAACTGTGCTGTATTCTGGACCTCAAACTTGCTGGTCAATGTGGG
GGCGCAGATGGAAACCAAGCTGCTGCGGGGACACAGGCGGCAGGGGGGACACGGGCGGCAGGGGGAACAC
AGGGAACAGGGGGAACTGGGGCCACAGGTGCAGCGGCCACCACTGCTGCACCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_134391
ORF Size 336 bp
Insert Size 336
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_134391.1, NP_599218.1
RefSeq Size 653
RefSeq ORF 336
Locus ID 171412
Gene Summary may play a role in antimicrobial defense of sperm in the epididymis and in the female reproductive tract [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.