Dynll2 (NM_080697) Rat Untagged Clone

CAT#: RN204510

Dynll2 (untagged ORF) - Rat dynein light chain LC8-type 2 (Dynll2), (10 ug)


  "NM_080697" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Dynll2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Dynll2
Synonyms Dlc2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204510 representing NM_080697
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGACCGGAAGGCAGTGATCAAGAACGCAGACATGTCTGAGGACATGCAACAGGATGCCGTTGACT
GCGCCACTCAGGCCATGGAGAAGTACAACATAGAGAAGGACATTGCTGCCTATATCAAGAAGGAATTCGA
CAAGAAATATAACCCTACCTGGCATTGTATCGTGGGCCGAAATTTTGGCAGCTATGTCACACACGAGACA
AAGCACTTCATCTATTTTTACTTGGGTCAAGTTGCAATCCTCCTCTTCAAGTCAGGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_080697
ORF Size 270 bp
Insert Size 270
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_080697.2, NP_542428.1
RefSeq Size 2370
RefSeq ORF 270
Locus ID 140734
Gene Summary gephyrin-binding protein that plays a role in postsynaptic targeting of neurotransmitter receptors or scaffolding proteins [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.