Atp5e (NM_139099) Rat Untagged Clone

CAT#: RN204682

Atp5e (untagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (Atp5e), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_139099" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Atp5e"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Atp5e
Synonyms Atp5e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204682 representing NM_139099
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGGCGTACTGGCGACAGGCTGGACTCAGCTACATCCGGTTCTCCCAGATCTGTGCAAAAGCAGTGA
GGGATGCCCTGAAGACTGAGTTCAAAGCGAACGCTGAGAAGACTTCGGGCACCAGCATAAAAACAGTGAA
AATAAAGAAGGAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_139099
ORF Size 156 bp
Insert Size 156
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_139099.1, NP_620799.1
RefSeq Size 404
RefSeq ORF 156
Locus ID 245958
Gene Summary human homolog is the epsilon subunit of human ATP synthase [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.