Apoc2 (NM_001085352) Rat Untagged Clone

CAT#: RN204804

Apoc2 (untagged ORF) - Rat apolipoprotein C-II (Apoc2), (10 ug)


  "NM_001085352" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Apoc2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Apoc2
Synonyms RGD1560725
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204804 representing NM_001085352
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGTCTCGTTTCTTCCTGGCTCTATTCCTGGCTCTCCTAGTGTTGGGAAACGAGGTCCAGGGGACCG
AGGAAGATGATCCGGGCAGCTCAGCTCTGCTGGACACGGTACAGGAGCACTTGTTCAGTTACTGGAACTC
TGCCAAGGCGGCCGCCGGAGAACTATACCAGAAGACATACCTGACCAGCGTGGACGAGAAACTGAGGGAC
ATGTACAGCAAAAGCTCGGCGGCCATGACCACGTACGCTGGCATTTTTACAGACCAGCTCCTTACTCTCC
TGAAAGGAGAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001085352
ORF Size 294 bp
Insert Size 294
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001085352.1, NP_001078821.1
RefSeq Size 518
RefSeq ORF 294
Locus ID 292697
Gene Summary cofactor and activator of lipoprotein lipase; crucial for the hydrolysis of triacylglycerols and very-low-density lipoproteins; mRNA found mainly in the liver [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.