Ndufa1 (NM_001108813) Rat Untagged Clone

CAT#: RN204838

Ndufa1 (untagged ORF) - Rat NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (Ndufa1), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_001108813" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ndufa1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ndufa1
Synonyms RGD1560955
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204838 representing NM_001108813
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGTTCGAGATTCTCCCTGGCCTCGCCATTATGGGGGTGTGCCTGGTCATCCCCGGGGTGTCCACTG
CGTACATCCACAAGTTCACCAACGGGGGCAAGGAAAAGAGAGTTGCTCGAGTTCATTACCAATGGTATTT
GATGGAACGCGATAGACGCATCTCTGGTGTCAATCGCTACTATGTGTCCAAGGGCCTGGAGAACATTGAC
TAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001108813
ORF Size 213 bp
Insert Size 213
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001108813.2, NP_001102283.2
RefSeq Size 440
RefSeq ORF 213
Locus ID 363441

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.