Mpz (NM_017027) Rat Untagged Clone

CAT#: RN204943

Mpz (untagged ORF) - Rat myelin protein zero (Mpz), (10 ug)


  "NM_017027" in other vectors (3)

Reconstitution Protocol

USD 420.00

5 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Mpz
Synonyms MPP; P0
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204943 representing NM_017027
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCCTGGGGCTCCCTCATCCAGCCCCAGCCCTATCCTGGCTGCCCTGCTCTTCTCTTCTTTGGTGC
TGTCCCCAACCCTGGCCATTGTGGTTTACACGGACAGGGAAGTCTATGGTGCTGTGGGCTCCCAGGTGAC
CCTGCACTGCTCCTTCTGGTCCAGTGAATGGGTCTCAGATGACATCTCTTTTACCTGGCGCTACCAGCCT
GAAGGAGGCCGAGATGCCATTTCAATCTTCCACTATGCCAAGGGTCAACCTTACATCGATGAGGTGGGGA
CCTTCAAGGAGCGCATCCAGTGGGTAGGGGACCCTAGCTGGAAGGATGGCTCCATTGTCATACACAACCT
AGACTACAGTGACAACGGCACTTTCACATGTGATGTCAAAAACCCACCGGACATAGTGGGCAAGACGTCT
CAGGTCACGCTCTATGTCTTTGAAAAAGTGCCCACTAGGTATGGGGTGGTGTTGGGAGCCGTGATCGGTG
GCATCCTCGGGGTGGTGCTGTTGCTGCTGTTGCTCTTCTACCTGATCCGGTACTGCTGGCTGCGCAGGCA
GGCTGCCCTGCAGAGGAGGCTCAGTGCCATGGAGAAGGGGAAATTTCACAAGTCTTCTAAGGACTCCTCG
AAGCGCGGGCGGCAGACGCCAGTGCTGTATGCCATGCTGGACCACAGCCGAAGCACCAAAGCTGCCAGTG
AGAAGAAATCTAAAGGGCTGGGGGAGTCTCGCAAGGATAAGAAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_017027
ORF Size 747 bp
Insert Size 747
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_017027.2, NP_058723.2
RefSeq Size 2018
RefSeq ORF 747
Locus ID 24564
Gene Summary This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2015]
Transcript Variant: This transcript (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (MPZ, also known as P0) results from translation termination at the upstream UAG stop codon, while the longer isoform (L-MPZ) results from UAG stop codon readthrough to the downstream UGA termination codon. This RefSeq represents the shorter isoform (MPZ).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.