Scgb1d2 (NM_177482) Rat Untagged Clone

CAT#: RN205015

Scgb1d2 (untagged ORF) - Rat prostatic steroid binding protein C1 (Psbpc1), (10 ug)


  "NM_177482" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Scgb1d2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Scgb1d2
Synonyms Pbpc1bs; Psbpc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN205015 representing NM_177482
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCACCATTAAGCTGAGCCTGTGTCTTCTGATCATGCTGGCTGTTTGTTGCTATGAAGCTAATGCTA
GCCAGATCTGTGAACTTGTTGCCCATGAAACCATAAGCTTCTTAATGAAAAGTGAGGAAGAACTGAAGAA
GGAACTTGAGATGTATAATGCACCTCCAGCAGCTGTTGAAGCAAAACTGGAAGTGAAGAGATGTGTAGAC
CAGATGAGCAATGGAGACAGATTGGTAGTAGCAGAAACACTGGTATACATTTTTTTGGAATGTGGTGTGA
AACAATGGGTAGAAACATATTATCCTGAGATCGATTTCTACTACGATATGAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_177482
ORF Size 336 bp
Insert Size 336
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_177482.1, NP_803435.1
RefSeq Size 412
RefSeq ORF 336
Locus ID 309203
Gene Summary member of the uteroglobin superfamily; major secretory glycoprotein of the rat ventral prostate gland [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.