Fcer1g (NM_001131001) Rat Untagged Clone

CAT#: RN205035

Fcer1g (untagged ORF) - Rat Fc fragment of IgE, high affinity I, receptor for, gamma polypeptide (Fcer1g), (10 ug)


  "NM_001131001" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fcer1g"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Fcer1g
Synonyms MGC188226
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN205035 representing NM_001131001
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCCCAGCGGTGATCTTGTTCTTGCTCCTTTTGGTGGAAGAAGCAGCTGCCCTAGGAGAGCCGCAGC
TCTGCTATATCCTGGATGCCATCCTGTTTTTGTATGGTATTGTCCTTACCCTGCTCTACTGTCGACTCAA
GATCCAGGTCCGAAAGGCAGACATAGCCAGCCGTGAGAAATCAGATGCTGTCTACACGGGCCTGAACACC
CGGAACCAGGAGACATATGAGACTCTGAAACATGAGAAACCACCCCAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001131001
ORF Size 261 bp
Insert Size 261
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001131001.1, NP_001124473.1
RefSeq Size 657
RefSeq ORF 261
Locus ID 25441
Gene Summary subunit of high-affinity receptor for immunoglobulin E; mediates the release of mediators responsible for allergic symptoms [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.