Prlh (NM_022222) Rat Untagged Clone

CAT#: RN205572

Prlh (untagged ORF) - Rat prolactin releasing hormone (Prlh), (10 ug)


  "NM_022222" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Prlh"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Prlh
Synonyms Prh; prrp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN205572 representing NM_022222
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCTGAAGACGTGGCTTCTGTGCTTGCTGCTGCTAAGCTTGGTCCTCCCAGGGGCTTCCAGCCGAG
CCCACCAGCACTCCATGGAGACAAGAACCCCTGATATCAATCCTGCCTGGTACACGGGCCGCGGGATCAG
GCCTGTGGGCCGCTTCGGCAGGAGAAGGGCAACCCCGAGGGATGTCACTGGACTTGGCCAACTCAGCTGC
CTCCCACTGGATGGACGCACCAAGTTCTCTCAGCGTGGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022222
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_022222.1, NP_071558.1
RefSeq Size 252
RefSeq ORF 252
Locus ID 63850
Gene Summary Stimulates prolactin (PRL) release and regulates the expression of prolactin through its receptor GPR10. May stimulate lactotrophs directly to secrete PRL. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.