Pcbd1 (NM_001007601) Rat Untagged Clone

CAT#: RN206379

Pcbd1 (untagged ORF) - Rat pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (Pcbd1), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Pcbd1
• Synonyms: DCoH; Pcbd; Pcd; Phs; TCF1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN206379 representing NM_001007601
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTGGCAAGGCACACAGGCTGAGTGCTGAGGAACGGGACCAGCTGCTGCCAAACCTGCGGGCTGTGG
  GGTGGAATGAACTGGAAGGCCGAGATGCCATCTTCAAACAGTTCCATTTTAAAGACTTCAACAGGGCTTT
  TGGCTTCATGACAAGAGTCGCCCTGCAGGCTGAAAAGCTGGACCACCATCCCGAGTGGTTTAACGTGTAC
  AACAAGGTCCATATCACCTTGAGCACCCACGAATGTGCCGGTCTTTCTGAACGGGATATAAACCTGGCCA
  GCTTCATCGAACAAGTTGCCGTGTCTATGACATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001007601
• Insert Size: 315 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001007601.2, NP_001007602.1
• RefSeq Size: 776 bp
• RefSeq ORF: 315 bp
• Locus ID: 29700
• Cytogenetics: 20q11
• Gene Summary: This gene encodes a member of the pterin-4-alpha-carbinolamine dehydratase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein functions as both a dehydratase involved in tetrahydrobiopterin biosynthesis, and as a cofactor for HNF1A-dependent transcription. [provided by RefSeq, Jan 2014]