Fxyd1 (NM_031648) Rat Untagged Clone
CAT#: RN206754
Fxyd1 (untagged ORF) - Rat FXYD domain-containing ion transport regulator 1 (Fxyd1), (10 ug)
"NM_031648" in other vectors (3)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Fxyd1 |
Synonyms | Plm |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN206754 representing NM_031648
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGGCAATGGCATCTCCCGGCCACATCCTGATTGTCTGTGTGTGTCTCCTCTCCATGGCCAGTGCAG AAGCTCCGCAGGAACCAGATCCATTCACCTACGATTACCACACCCTGCGGATCGGCGGCCTCACTATCGC TGGGATCCTCTTCATCTTGGGCATCCTTATCATCCTTAGCAAAAGATGCCGGTGCAAATTCAACCAACAG CAGAGAACTGGGGAACCCGACGAAGAGGAGGGAACTTTCCGCAGCTCCATCCGCCGTCTGTCCACCCGCA GGCGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_031648 |
ORF Size | 288 bp |
Insert Size | 288 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_031648.2, NP_113836.2 |
RefSeq Size | 533 |
RefSeq ORF | 288 |
Locus ID | 58971 |
Gene Summary | This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR206754 | Fxyd1 (Myc-DDK-tagged ORF) - Rat FXYD domain-containing ion transport regulator 1 (Fxyd1), (10 ug) |
USD 420.00 |
|
RR206754L3 | Lenti ORF clone of Fxyd1 (Myc-DDK-tagged ORF) - Rat FXYD domain-containing ion transport regulator 1 (Fxyd1), (10 ug) |
USD 640.00 |
|
RR206754L4 | Lenti ORF clone of Fxyd1 (mGFP-tagged ORF) - Rat FXYD domain-containing ion transport regulator 1 (Fxyd1), (10 ug) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review