Ly6e (NM_001017467) Rat Untagged Clone

CAT#: RN206764

Ly6e (untagged ORF) - Rat lymphocyte antigen 6 complex, locus E (Ly6e), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Ly6e
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN206764 representing NM_001017467
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTGCCGCTTCCAGCATGAGAGTCTTCTTGCCTGTGCTGCTGGCAGCCCTTCTGGGTGTGGAACAAG
  TCCATTCCCTGATGTGCTTCTCCTGCACCGATCAGAAGAACAATATCAATTGCCTATGGCCGGTATCATG
  CTCCAGCACAGACAATTACTGTATCACGTTATCTGCTGCCGCGGGCTTCGGGAATGTCAACCTTGGCTAC
  ACCCTGAATAAGGGTTGCTCCCCCACCTGCCCCCGTGAAAACATCAATATTAACCTCGGTGTGGCGTCCG
  TGAATAGCTACTGCTGCCAGAGCTCCTTCTGCAATTTCAGCACGGCTGGCCTTGGACTTCGTGCTAGTAT
  CCCACTGCTGGGCCTTGGACTCCTGCTCAGCTTGTTGGCTGTGCTGCGGCTGAGCCCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001017467
• Insert Size: 411 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001017467.1, NP_001017467.1
• RefSeq Size: 1289 bp
• RefSeq ORF: 411 bp
• Locus ID: 362934
• Cytogenetics: 7q34