Gng13 (NM_001135918) Rat Untagged Clone

CAT#: RN206870

Gng13 (untagged ORF) - Rat guanine nucleotide binding protein (G protein), gamma 13 (Gng13), (10 ug)


  "NM_001135918" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gng13"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Gng13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN206870 representing NM_001135918
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGAGTGGGATGTGCCCCAGATGAAGAAGGAGGTGGAGAGCCTCAAGTACCAACTGGCCTTCAAGA
GGGAGATGTCGTCCAAGACCATCCCCGAGCTCCTCAAGTGGATTGAGGACGGGATCCCCAAGGACCCCTT
CCTGAACCCGGACCTGATGAAGAACAACCCTTGGGTGGAGAAGGCCAAGTGTACCATCCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001135918
ORF Size 204 bp
Insert Size 204
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001135918.1, NP_001129390.1
RefSeq Size 354
RefSeq ORF 204
Locus ID 685451

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.