Eloc (NM_022593) Rat Untagged Clone

CAT#: RN206921

Tceb1 (untagged ORF) - Rat transcription elongation factor B (SIII), polypeptide 1 (Tceb1), (10 ug)


  "NM_022593" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Eloc"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Eloc
Synonyms Tceb1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN206921 representing NM_022593
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGCCCTGATGCCATGTATGTGAAATTAATATCTT
CTGATGGTCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGAACAATAAAGGCCATGTTGAG
TGGTCCAGGTCAGTTTGCGGAGAATGAAACCAATGAGGTCAACTTTAGAGAGATCCCTTCACATGTGCTA
TCGAAAGTGTGCATGTATTTTACCTACAAGGTCCGCTATACTAACAGCTCCACTGAAATTCCTGAATTCC
CAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCCGCGAACTTCCTAGATTGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022593
ORF Size 339 bp
Insert Size 339
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_022593.4, NP_072115.1
RefSeq Size 2050
RefSeq ORF 339
Locus ID 64525
Gene Summary 15 kDa subunit of the transcription factor B (SIII) complex, also known as elongin C; releases RNA polymerase II from transient pausing at arresting sites [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.