Eloc (NM_022593) Rat Untagged Clone

CAT#: RN206921

Tceb1 (untagged ORF) - Rat transcription elongation factor B (SIII), polypeptide 1 (Tceb1), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Eloc
• Synonyms: Tceb1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN206921 representing NM_022593
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGCCCTGATGCCATGTATGTGAAATTAATATCTT
  CTGATGGTCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGAACAATAAAGGCCATGTTGAG
  TGGTCCAGGTCAGTTTGCGGAGAATGAAACCAATGAGGTCAACTTTAGAGAGATCCCTTCACATGTGCTA
  TCGAAAGTGTGCATGTATTTTACCTACAAGGTCCGCTATACTAACAGCTCCACTGAAATTCCTGAATTCC
  CAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCCGCGAACTTCCTAGATTGTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_022593
• ORF Size: 339 bp
• Insert Size: 339
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_022593.4, NP_072115.1
• RefSeq Size: 2050
• RefSeq ORF: 339
• Locus ID: 64525
• Gene Summary: 15 kDa subunit of the transcription factor B (SIII) complex, also known as elongin C; releases RNA polymerase II from transient pausing at arresting sites [RGD, Feb 2006]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.