Cxcl1 (NM_030845) Rat Untagged Clone

CAT#: RN207378

Cxcl1 (untagged ORF) - Rat chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (Cxcl1), (10 ug)


  "NM_030845" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cxcl1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cxcl1
Synonyms CINC-1; Gro1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207378 representing NM_030845
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCTCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCCTGTGCTGGCCACCAGCCGCCAAGCCACAG
GGGCGCCCGTCGCCAATGAGCTGCGCTGTCAGTGCCTGCAGACAGTGGCAGGGATTCACTTCAAGAACAT
CCAGAGTTTGAAGGTGATGCCGCCAGGACCCCACTGCACCCAAACCGAAGTCATAGCCACACTCAAGAAT
GGTCGCGAGGCTTGCCTTGACCCTGAAGCCCCCATGGTTCAGAAGATTGTCCAAAAGATGCTAAAGGGTG
TCCCCAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_030845
ORF Size 291 bp
Insert Size 291
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_030845.1, NP_110472.1
RefSeq Size 929
RefSeq ORF 291
Locus ID 81503
Gene Summary acts as a neutrophil chemoattractant; may play a role in acute phase inflammatory response [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.