Mln (NM_001110056) Rat Untagged Clone

CAT#: RN207466

Mln (untagged ORF) - Rat motilin (Mln), (10 ug)


  "NM_001110056" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Mln
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207466 representing NM_001110056
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGTCCTGCAAGGCTGTGGTCATCTTGCTAGAGGTGTATGCAGCTGCCATGCTGACCTCCCAGATTG
AAGCTTTCCTTACCATCTTCGTGCACGGTGAACTCCAGAGACTGCAGTTGACTGCTCCAGCACGAATGGG
AGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001110056
ORF Size 147 bp
Insert Size 147
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001110056.1, NP_001103526.1
RefSeq Size 206
RefSeq ORF 147
Locus ID 100126231

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.