S100b (NM_013191) Rat Untagged Clone

CAT#: RN207674

S100b (untagged ORF) - Rat S100 calcium binding protein B (S100b), (10 ug)


  "NM_013191" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "S100b"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol S100b
Synonyms S100P
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207674 representing NM_013191
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGAGCTGGAGAAGGCCATGGTTGCCCTCATTGATGTCTTCCATCAGTATTCAGGGAGAGAGGGTG
ACAAGCACAAGCTGAAGAAGTCAGAACTGAAGGAGCTCATCAACAACGAGCTCTCTCACTTCCTGGAGGA
AATCAAAGAGCAGGAAGTGGTGGACAAAGTGATGGAGACGCTGGACGAAGATGGGGATGGGGAGTGTGAC
TTCCAGGAGTTTATGGCCTTCGTCTCCATGGTGACCACAGCCTGTCATGAGTTCTTTGAACATGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013191
ORF Size 279 bp
Insert Size 279
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013191.1, NP_037323.1
RefSeq Size 1488
RefSeq ORF 279
Locus ID 25742
Gene Summary binds GTPase activating protein IQGAP1; may play a role in cell membrane rearrangement [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.