Nupr1 (NM_053611) Rat Untagged Clone

CAT#: RN207721

Nupr1 (untagged ORF) - Rat nuclear protein 1 (Nupr1), (10 ug)


  "NM_053611" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Nupr1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Nupr1
Synonyms p8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207721 representing NM_053611
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACTTTGCCACCAACAGCCCACACTTCCCAGCAACCTGTAAACATAGAGGACGAAGATGGGATCC
TGGATGAGTATGACCAGTACAGCCTGGCCCAATCTTATGTCGTCGGTGGAGGTCGGAAAGGACGTACCAA
GAGAGAAGCTGCTGCCAACACCAACCGCCCCAGCCCTGGTGGGCATGAGAGGAAGCTGCTGACCAAGTTC
CAGAACTCTGAAAGGAAAAAGGCCTGGCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053611
ORF Size 243 bp
Insert Size 243
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053611.2, NP_446063.1
RefSeq Size 634
RefSeq ORF 243
Locus ID 100912108
Gene Summary may act as a transcription factor to regulate pancreatic cell growth; expression increased in pancreatitis [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.