Atpif1 (NM_012915) Rat Untagged Clone

CAT#: RN207924

Atpif1 (untagged ORF) - Rat ATPase inhibitory factor 1 (Atpif1), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_012915" in other vectors (3)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Atpif1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Atpif1
Synonyms Atpi; Atpif1; IF1PA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207924 representing NM_012915
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGCTCGGCGTTGGCGGTTCGGGCTCGGCTCGGTGTCTGGGGTATGAGGGTCCTGCAAACCCGAG
GCTTCGGCTCGGACTCGTCGGAGAGCATGGATTCGGGCGCTGGCTCCATCCGAGAAGCTGGTGGGGCCTT
CGGGAAACGAGAGAAGGCTGAAGAGGATCGGTACTTCCGAGAGAAGACTAGAGAGCAGCTGGCTGCCTTG
AAGAAGCACCATGAAGATGAGATTGACCACCATTCGAAGGAGATAGAGCGTCTGCAAAAACAGATCGAAC
GGCATAAGAAGAAGATTAAATACCTAAAGAATAGTGAGCATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012915
ORF Size 324 bp
Insert Size 324
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_012915.2, NP_037047.2
RefSeq Size 481
RefSeq ORF 324
Locus ID 25392
Gene Summary inhibits ATP hydrolysis catalyzed by the mitochondrial ATP synthase/ATPase complex [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.