Fxyd4 (NM_022388) Rat Untagged Clone

CAT#: RN208302

Fxyd4 (untagged ORF) - Rat FXYD domain-containing ion transport regulator 4 (Fxyd4), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Fxyd4
• Synonyms: Chif
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN208302 representing NM_022388
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGGAATAACCTGTGCCTTTCTCCTGGTGCTAGCAGGTCTGCCTGTCTTGGAAGCCAATGGTCCAG
  TTGATAAAGGCAGTCCCTTCTACTACGACTGGGAGAGCCTGCAACTGGGAGGAATGATCTTTGGGGGGCT
  CCTGTGCATCGCTGGAATTGCCATGGCCCTGAGTGGCAAGTGCAAATGTAGGCGCAACCATACGCCCAGT
  TCCTTACCTGAGAAAGTCACTCCACTCATCACTCCAGGCTCTGCCAGTACCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_022388
• ORF Size: 264 bp
• Insert Size: 264
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_022388.1, NP_071783.1
• RefSeq Size: 1362
• RefSeq ORF: 264
• Locus ID: 64190
• Gene Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. [provided by RefSeq, Jul 2008]