Mllt11 (NM_001013912) Rat Untagged Clone
CAT#: RN208423
Mllt11 (untagged ORF) - Rat myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 (Mllt11), (10 ug)
"NM_001013912" in other vectors (3)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Mllt11 |
Synonyms | RGD1305525 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN208423 representing NM_001013912
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGGGACCCTGTGAGTAGCCAGTACAGCTCCTTTCTTTTCTGGAGGATGCCCATCCCAGAACTGGATC TGTCGGAGCTGGAAGGCCTGGGCCTGTCAGATTCACCTACCTACAAGAGCAAGGAGAGCAACAGCATTGG CAAAATGGGTGGGCAGGCAACCGGAGCTGAGCGGAAGAGCCCTGAAGGCGACCCCCTCCTTGAGTATAGC ACCTTCAACTTCTGGAGAGCCCCTATTGCCAGCATCCGCTCGATCGACCTGGACTTGCTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001013912 |
Insert Size | 273 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001013912.1, NP_001013934.1 |
RefSeq Size | 1406 bp |
RefSeq ORF | 273 bp |
Locus ID | 295264 |
Cytogenetics | 2q34 |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR208423 | Mllt11 (Myc-DDK-tagged ORF) - Rat myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 (Mllt11), (10 ug) |
USD 420.00 |
|
RR208423L3 | Lenti ORF clone of Mllt11 (Myc-DDK-tagged ORF) - Rat myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 (Mllt11), (10 ug) |
USD 640.00 |
|
RR208423L4 | Lenti ORF clone of Mllt11 (mGFP-tagged ORF) - Rat myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 (Mllt11), (10 ug) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review