Fkbp1a (NM_013102) Rat Untagged Clone

CAT#: RN208433

Fkbp1a (untagged ORF) - Rat FK506 binding protein 1a (Fkbp1a), (10 ug)


  "NM_013102" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fkbp1a"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Fkbp1a
Synonyms Fkbp2; FKBP12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN208433 representing NM_013102
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAGTGCAGGTGGAGACCATCTCTTCTGGAGACGGGCGCACCTTCCCGAAGCGCGGCCAGACCTGCG
TGGTACACTACACGGGGATGCTTGAAGATGGGAAGAAATTTGACTCCTCTCGGGACAGAAACAAGCCTTT
TAAGTTTACACTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTAGCCCAGATGAGTGTGGGC
CAGAGAGCCAAACTGATAATCTCCCCAGACTATGCCTATGGAGCCACCGGGCACCCAGGCATCATCCCAC
CACATGCTACTCTTGTTTTTGATGTGGAGCTTCTAAAACTGGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013102
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013102.3, NP_037234.2
RefSeq Size 1522
RefSeq ORF 327
Locus ID 25639
Gene Summary mediates islet microsome Ca2+ release through binding to ryanodine receptor (RyR) and catalyzes the cis-trans isomerization of peptidyl-prolyl amide peptide bonds [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.