Mt1 (NM_138826) Rat Untagged Clone

CAT#: RN208880

Mt1a (untagged ORF) - Rat metallothionein 1a (Mt1a), (10 ug)


  "NM_138826" in other vectors (5)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Mt1
Synonyms Mt; Mt1a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN208880 representing NM_138826
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACCTGCTCCAGCTCCTGCGGCTGCAAGAACT
GCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCCGTGGGCTGCTCCAAATGTGCCCAGGG
CTGTGTCTGCAAAGGTGCCTCGGACAAGTGCACGTGCTGTGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_138826
ORF Size 186 bp
Insert Size 186
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_138826.4, NP_620181.1
RefSeq Size 389
RefSeq ORF 186
Locus ID 24567
Gene Summary may play a role in protecting the ovarian tissues from oxidative stress [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.