Selenow (NM_013027) Rat Untagged Clone

CAT#: RN209150

Sepw1 (untagged ORF) - Rat selenoprotein W, 1 (Sepw1), (Note, selenocysteine protein, internal stop codon, see reference data summary)

Specifications

Product Data

• Type: Rat Untagged Clone
• Symbol: Selenow
• Synonyms: SelW; Sepw1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN209150 representing NM_013027
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGCTAGCCGTTCGAGTCGTGTATTGTGGAGCTTGAGGCTATAAGCCCAAGTATCTCCAGCTCAAGG
  AGAAGCTAGAACATGAGTTCCCCGGATGCCTGGACATCTGTGGCGAGGGGACTCCCCAGGTCACCGGGTT
  CTTTGAAGTGACGGTAGCCGGGAAGTTGGTTCACTCCAAGAAGAGAGGTGATGGCTACGTGGATACAGAG
  AGCAAGTTCCGGAAACTGGTGACTGCCATCAAAGCCGCCTTGGCTCAGTGCCAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013027
• ORF Size: 267 bp
• Insert Size: 267
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_013027.3, NP_037159.4
• RefSeq Size: 717
• RefSeq ORF: 267
• Locus ID: 25545
• Gene Summary: This gene encodes a selenoprotein containing a selenocysteine (Sec) residue, which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is highly expressed in skeletal muscle and brain. It belongs to the SelWTH family, which possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif, suggesting a redox function for this gene. Studies in mouse show that this selenoprotein is involved in muscle growth and differentiation, and in the protection of neurons from oxidative stress during neuronal development. A pseudogene of this locus has been identified on chromosome 10. [provided by RefSeq, Aug 2017]