Dpm3 (NM_001109331) Rat Untagged Clone

CAT#: RN209247

Dpm3 (untagged ORF) - Rat dolichyl-phosphate mannosyltransferase polypeptide 3 (Dpm3), (10 ug)


  "NM_001109331" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Dpm3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Dpm3
Synonyms RGD1561807
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN209247 representing NM_001109331
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACGAAGTTAACACAGTGGCTTTGGGGACTGGCTCTCCTGGGCTCTGCATGGGCTGCCCTGACCATGG
GAGCTCTGGGTCTGGAGCTACCTTTACCCTGCCGGGAGGTCCTGTGGCCACTGCCTGCCTATCTGCTGGT
GTCCGCTGGCTGCTATGCCCTGGGCACTGTGGGCTATCGCGTAGCTACATTTCACGACTGCGAGGACGCC
GCCCGAGAGCTGCAGAGCCAGATCCTGGAGGCCCGAGCTGATTTAGCCCGCAAGGGCCTGCGCTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001109331
ORF Size 279 bp
Insert Size 279
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001109331.2, NP_001102801.1
RefSeq Size 394
RefSeq ORF 279
Locus ID 502017

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.