Mustn1 (NM_181368) Rat Untagged Clone

CAT#: RN210106

Mustn1 (untagged ORF) - Rat musculoskeletal, embryonic nuclear protein 1 (Mustn1), (10 ug)


  "NM_181368" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Mustn1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Mustn1
Synonyms Mustang
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210106 representing NM_181368
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCGAGGCTGGCACTCCTGAAGCCCCCATCAAGAAGAAGCGCCCCCCTGTGAAGGAAGAAGACCTGA
AGGGGGCCCGGGGGAGTCTGTCCAAGAACCAGGAGATCAAGTCTAAGACGTACCAGGTCATGCGGGACTA
TGAGCAAGCTGGCTCAGCTGCCCCATCTATATTCAGCCGCAACCGCACGGGCACCGAGACAGTCTTCGAG
AAGCCCAAAGAGGGACCTGCCAAGAGCGTCTTTGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_181368
ORF Size 249 bp
Insert Size 249
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_181368.3, NP_852033.1
RefSeq Size 1097
RefSeq ORF 249
Locus ID 290553
Gene Summary a nuclear protein thought to be involved in bone regeneration after injury and bone formation during embryogenesis [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.