Nedd8 (NM_138878) Rat Untagged Clone

CAT#: RN210118

Nedd8 (untagged ORF) - Rat neural precursor cell expressed, developmentally down-regulated 8 (Nedd8), (10 ug)


  "NM_138878" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Nedd8"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Nedd8
Synonyms CDK8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210118 representing NM_138878
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTAATTAAAGTGAAGACGCTGACTGGAAAGGAGATTGAGATTGACATCGAACCCACAGACAAGGTGG
AACGAATCAAGGAGCGTGTGGAAGAAAAAGAAGGAATTCCCCCACAACAGCAGCGGCTCATCTACAGTGG
CAAACAAATGAATGATGAGAAGACAGCAGCTGATTACAAGATTCTAGGTGGTTCCGTCCTCCACCTGGTG
TTGGCTCTTAGAGGAGGTGGTGGTCTTGGGCAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_138878
ORF Size 246 bp
Insert Size 246
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_138878.2, NP_620233.1
RefSeq Size 795
RefSeq ORF 246
Locus ID 25490
Gene Summary displays differential expression after induction by nerve growth factor [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.