Tmsb10 (NM_021261) Rat Untagged Clone

CAT#: RN210215

Tmsb10 (untagged ORF) - Rat thymosin, beta 10 (Tmsb10), (10 ug)


  "NM_021261" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tmsb10"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Tmsb10
Synonyms Ptmb10; THYb10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210215 representing NM_021261
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGACAAGCCGGACATGGGGGAAATCGCCAGCTTCGATAAGGCCAAGCTGAAGAAAACCGAGACGC
AGGAGAAGAACACCCTGCCGACCAAAGAGACCATTGAACAGGAAAAGAGGAGTGAAATCTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021261
ORF Size 135 bp
Insert Size 135
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_021261.2, NP_067084.1
RefSeq Size 489
RefSeq ORF 135
Locus ID 50665
Gene Summary actin-sequestering protein; binds actin monomers (G actin) and inhibits actin polymerization [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.