Camk2n1 (NM_173337) Rat Untagged Clone

CAT#: RN210549

Camk2n1 (untagged ORF) - Rat calcium/calmodulin-dependent protein kinase II inhibitor 1 (Camk2n1), (10 ug)


  "NM_173337" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Camk2n1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Camk2n1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210549 representing NM_173337
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGAGGTGCTGCCCTACGGCGACGAGAAGCTGAGCCCCTACGGCGACGGCGGCGACGTGGGCCAGA
TCTTCTCGTGCCGCCTGCAGGACACCAACAACTTCTTCGGCGCCGGGCAGAGCAAGCGGCCGCCCAAGCT
GGGCCAGATCGGCCGGAGCAAGCGCGTTGTTATTGAAGATGATAGGATCGATGACGTGCTGAAAACCATG
ACCGACAAGGCACCTCCTGGTGTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_173337
ORF Size 237 bp
Insert Size 237
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_173337.1, NP_775459.1
RefSeq Size 409
RefSeq ORF 237
Locus ID 287005
Gene Summary Ca2+/calmodulin-dependent-kinase II inhibitor protein [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.