Gng8 (NM_139185) Rat Untagged Clone

CAT#: RN210585

Gng8 (untagged ORF) - Rat guanine nucleotide binding protein (G protein), gamma 8 (Gng8), (10 ug)


  "NM_139185" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gng8"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Gng8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210585 representing NM_139185
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCAACAACATGGCCAAGATCGCTGAGGCCCGCAAGACGGTGGAGCAACTGAAGCTGGAGGTGAACA
TCGATCGCATGAAGGTGTCGCAGGCGGCAGCGGAGCTATTGGCTTTCTGCGAAACGCACGCTAAGGATGA
CCCACTGGTGACTCCTGTCCCTGCCGCCGAGAATCCCTTCCGCGACAAACGACTCTTTTGCACCCTGCTC
TGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_139185
ORF Size 213 bp
Insert Size 213
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_139185.1, NP_631924.1
RefSeq Size 560
RefSeq ORF 213
Locus ID 245986
Gene Summary gamma subunit for heterotrimeric G-protein; may be important for the development of olfactory sensory neurons [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.