Gpx1 (NM_030826) Rat Untagged Clone

CAT#: RN210732

Gpx1 (untagged ORF) - Rat glutathione peroxidase 1 (Gpx1), (Note, selenocysteine protein, internal stop codon, see reference data summary)

Specifications

Product Data

• Type: Rat Untagged Clone
• Symbol: Gpx1
• Synonyms: GSHPx; GSHPx-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN210732 representing NM_030826
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTGCTGCTCGGCTCTCCGCGGTGGCACAGTCCACCGTGTATGCCTTCTCCGCGCGCCCGCTGGCGG
  GCGGGGAGCCCGTGAGCCTGGGCTCCCTGCGGGGCAAGGTGCTGCTCATTGAGAATGTCGCGTCCCTCTG
  AGGCACCACGACCCGGGACTACACCGAAATGAATGATCTGCAGAAGCGTCTGGGGCCTCGTGGCCTGGTG
  GTGCTCGGTTTCCCGTGCAATCAGTTCGGACATCAGGAGAATGGCAAGAATGAAGAGATTCTGAATTCCC
  TCAAGTATGTCCGACCCGGTGGTGGGTTCGAGCCCAACTTTACATTGTTTGAGAAGTGCGAGGTGAATGG
  TGAGAAGGCTCACCCGCTCTTTACCTTCCTGCGGAATGCCTTGCCAGCACCCAGTGACGATCCCACTGCG
  CTCATGACCGACCCCAAGTACATCATTTGGTCCCCGGTGTGCCGCAACGACATTTCCTGGAACTTTGAGA
  AGTTCCTGGTAGGTCCAGACGGTGTTCCAGTGCGCAGATACAGCAGGCGCTTTCGCACCATCGACATCGA
  ACCCGATATAGAAGCCCTGCTGTCCAAGCAGCCTAGCAACCCCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_030826
• ORF Size: 606 bp
• Insert Size: 606
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_030826.3, NP_110453.3
• RefSeq Size: 898
• RefSeq ORF: 606
• Locus ID: 24404
• Gene Summary: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Jul 2016]