Gng5 (NM_024377) Rat Untagged Clone

CAT#: RN211213

Gng5 (untagged ORF) - Rat guanine nucleotide binding protein (G protein), gamma 5 (Gng5), (10 ug)


  "NM_024377" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gng5"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Gng5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211213 representing NM_024377
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGGTTCTTCTAGCGTCGCCGCCATGAAGAAGGTGGTTCAGCAACTCCGGCTGGAGGCCGGGCTCA
ACCGCGTGAAGGTTTCCCAGGCAGCTGCAGACTTGAAACAGTTCTGTCTGCAGAATGCTCAACATGACCC
TCTGCTGACTGGAGTGTCTTCAAGTACAAATCCCTTCAGACCCCAGAAAGTCTGCTCCTTTTTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024377
ORF Size 207 bp
Insert Size 207
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_024377.1, NP_077353.1
RefSeq Size 1392
RefSeq ORF 207
Locus ID 79218
Gene Summary heterotrimeric G protein subunit; may play a role in signal transduction [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.