Blcap (NM_133582) Rat Untagged Clone

CAT#: RN211272

Blcap (untagged ORF) - Rat bladder cancer associated protein homolog (human) (Blcap), (10 ug)


  "NM_133582" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Blcap"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Blcap
Synonyms MGC105330
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211272 representing NM_133582
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTATTGCCTCCAGTGGCTGCTGCCCGTCCTCCTCATCCCCAAGCCCCTCAACCCCGCTCTGTGGTTCA
GCCACTCCATGTTCATGGGCTTCTACCTGCTCAGCTTCCTCCTGGAACGGAAACCTTGCACGATATGTGC
CCTGGTCTTCCTGGCAGCCCTCTTTCTCATCTGCTATAGCTGCTGGGGCAATTGCTTCCTGTACCACTGC
TCCGATTCCCCGCTTCCAGAATCAGCCCATGACCCCGGTGTGGTGGGCACCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133582
ORF Size 264 bp
Insert Size 264
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_133582.3, NP_598266.1
RefSeq Size 2036
RefSeq ORF 264
Locus ID 171113
Gene Summary human homolog is downregulated during bladder transitional cell carcinoma progression [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.