Timm13 (NM_145781) Rat Untagged Clone

CAT#: RN211452

Timm13 (untagged ORF) - Rat translocase of inner mitochondrial membrane 13 homolog (yeast) (Timm13), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_145781" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Timm13"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Timm13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211452 representing NM_145781
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACAGCGGATTCGGCTCGGACTTCGGCGGCACGGGTGGTGGGAAGCTGGACCCGGGAGCCATTATGG
AACAGGTGAAAGTGCAGATCGCCGTGGCCAATGCGCAGGAGCTGCTACAGAGGATGACGGACAAGTGTTT
CCGGAAGTGCATCGGGAAGCCCGGGGGCTCCTTAGATAACTCGGAGCAGAAATGCATCGCCATGTGCATG
GACCGGTACATGGACGCCTGGAACACCGTGTCCCGCGCCTACAACTCCCGACTGCAGCGGGAACGAGCCA
ACATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_145781
ORF Size 288 bp
Insert Size 288
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_145781.2, NP_665724.1
RefSeq Size 822
RefSeq ORF 288
Locus ID 252928
Gene Summary small zinc finger protein involved in mitochondrial carrier import [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.