S100g (NM_012521) Rat Untagged Clone

CAT#: RN211657

S100g (untagged ORF) - Rat S100 calcium binding protein G (S100g), (10 ug)


  "NM_012521" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "S100g"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol S100g
Synonyms Cabp; Calb3; Cbpi; Rncalbd9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211657 representing NM_012521
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGCTAAGAAATCTCCCGAAGAAATGAAGAGCATTTTTCAAAAATATGCAGCCAAAGAAGGCGATC
CAAACCAGCTGTCCAAGGAGGAGCTGAAGCTGCTGATTCAGTCAGAGTTCCCCAGCCTCCTGAAGGCTTC
AAGTACTCTAGACAATCTCTTTAAAGAGCTGGATAAGAACGGTGATGGAGAAGTTAGCTATGAAGAATTC
GAAGTTTTCTTCAAAAAGTTATCACAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012521
ORF Size 240 bp
Insert Size 240
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_012521.2, NP_036653.1
RefSeq Size 405
RefSeq ORF 240
Locus ID 24249
Gene Summary calcium-binding protein that may be involved in intestinal calcium regulation; transcriptionally activated by 1,25-dihydroxyvitamin D3 [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.