Ntf4 (NM_013184) Rat Untagged Clone

CAT#: RN211853

Ntf4 (untagged ORF) - Rat neurotrophin 4 (Ntf4), (10 ug)


  "NM_013184" in other vectors (3)

Reconstitution Protocol

USD 420.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ntf4"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ntf4
Synonyms NT4P; Ntf5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211853 representing NM_013184
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTCCCTCGCCACTCCTGCTCTCTCCTCCTTTTCCTTCTCCTCCTCCCCAGCGTCCCCATGGAGCCCC
AACCCCCCTCCTCCACCCTGCCCCCTTTTCTGGCTCCTGAGTGGGACCTCTTGTCTCCCCGAGTGGCCCT
GTCAAGGGGCACCCCTGCCGGGCCCCCTCTCCTCTTCCTGCTGGAGGCCGGGGCCTATGGGGAGCCGGCA
GGGGCCCCAGCCAACCGCAGCCGGCGCGGGGTGAGTGAGACGGCACCGGCAAGCCGCCGGGGTGAGCTGG
CAGTGTGCGATGCAGTGAGTGGCTGGGTGACCGACCGGCGGACAGCTGTGGACTTGCGTGGGCGCGAGGT
GGAGGTGCTGGGCGAGGTGCCTGCGGCAGGTGGCAGTCCCCTGCGTCAGTACTTCTTCGAGACGCGCTGC
AAGGCCGAAAGCGCTGGGGAAGGTGGCCCAGGTGTGGGCGGAGGGGGCTGTCGCGGCGTGGATCGGAGGC
ACTGGCTCTCAGAATGCAAGGCTAAACAGTCCTATGTGCCGGCGTTGACTGCAGACTCTCAGGGCCGCGT
GGGCTGGCGCTGGATTCGGATCGACACCGCTTGCGTCTGCACGCTCCTCAGCCGAACAGGCCGTGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013184
ORF Size 630 bp
Insert Size 630
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_013184.3, NP_037316.2
RefSeq Size 1338
RefSeq ORF 630
Locus ID 25730
Gene Summary promotes the survival of peripheral sensory and sympathetic neurons [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.