Serp1 (NM_030835) Rat Untagged Clone

CAT#: RN211903

Serp1 (untagged ORF) - Rat stress-associated endoplasmic reticulum protein 1 (Serp1), (10 ug)


  "NM_030835" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Serp1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Serp1
Synonyms RAMP4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211903 representing NM_030835
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCGCCAAGCAGAGGATCCGTATGGCCAACGAGAAGCACAGCAAGAACATAACTCAGCGCGGCAACG
TCGCTAAGACCTCGAGAAATGCCCCCGAAGAAAAGGCGTCGGTAGGACCCTGGTTATTGGCCCTCTTCAT
TTTTGTCGTTTGTGGATCTGCAATTTTCCAGATTATTCAAAGTATCAGGATGGGCATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_030835
ORF Size 201 bp
Insert Size 201
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_030835.2, NP_110462.1
RefSeq Size 2442
RefSeq ORF 201
Locus ID 80881
Gene Summary may be involved in glycosylation modification of secretory and membrane proteins including glycosylation of MHC class II-associated invariant chain (li) [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.