Bet1l (NM_019368) Rat Untagged Clone

CAT#: RN211912

Bet1l (untagged ORF) - Rat blocked early in transport 1 homolog (S. cerevisiae) like (Bet1l), (10 ug)


  "NM_019368" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Bet1l"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Bet1l
Synonyms Bet1; Gs15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211912 representing NM_019368
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGATTGGACTCGAGCTCAGAGTTCTGGTGCTGTGGAGGAGATTCTAGACAGAGAGAACAAGCGGA
TGGCTGACAGCCTGGCCTCTAAGGTCACCAGGCTTAAATCGCTGGCTTTGGACATCGACAGGGACACGGA
AGACCAGAACCGATACCTAGATGGCATGGACTCAGATTTCACAAGTGTGACTGGCCTACTCACAGGGAGT
GTGAAGCGCTTTTCCACGGTGGCACGGTCTGGGCGAGACAACCGGAAGCTTCTGTGTGGTATGGCTGTGG
TCTTAATTGTGGCCTTCTTCATCCTCTCCTACCTCTTGTCGAGGACAAGGACGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019368
ORF Size 336 bp
Insert Size 336
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_019368.3, NP_062241.2
RefSeq Size 1411
RefSeq ORF 336
Locus ID 54400
Gene Summary a soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE); involved in vesicular transport [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.