Gng11 (NM_022396) Rat Untagged Clone

CAT#: RN211957

Gng11 (untagged ORF) - Rat guanine nucleotide binding protein (G protein), gamma 11 (Gng11), (10 ug)


  "NM_022396" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gng11"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Gng11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211957 representing NM_022396
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCGCCCTTCACATTGAGGATCTGCCGGAAAAGGAAAAACTGAAGATGGAGGTTGAGCAACTTCGCA
AAGAAGTGAAGTTGCAGAGACAACAGGTGTCTAAATGTTCTGAGGAAATAAAGAACTACATTGAAGAACG
TTCTGGAGAGGATCCTCTGGTAAAGGGAATTCCAGAAGACAAGAATCCCTTCAAAGAAAAGGGCAGCTGT
GTCATTTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022396
ORF Size 222 bp
Insert Size 222
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_022396.2, NP_071791.1
RefSeq Size 1833
RefSeq ORF 222
Locus ID 64199
Gene Summary human homolog is a G protein gamma subunit [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.