Snap25 (NM_030991) Rat Untagged Clone

CAT#: RN212183

Snap25 (untagged ORF) - Rat synaptosomal-associated protein 25 (Snap25), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Snap25
• Synonyms: SNAP-25a; SNAP-25B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN212183 representing NM_030991
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGAGGACGCAGACATGCGTAATGAACTGGAGGAGATGCAGAGGAGGGCTGACCAGCTGGCTGATG
  AGTCCCTGGAAAGCACCCGTCGCATGCTGCAGCTGGTCGAAGAGAGTAAAGATGCTGGCATCAGGACTTT
  GGTTATGTTGGATGAGCAAGGCGAACAACTGGAACGCATTGAGGAAGGGATGGACCAAATCAATAAGGAT
  ATGAAAGAAGCAGAAAAGAATTTGACGGACCTAGGAAAATTCTGCGGGCTTTGTGTGTGTCCCTGTAACA
  AGCTTAAATCCAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGATGGAGTAGTGGCCAGCCAGCC
  TGCCCGTGTGGTGGATGAACGGGAGCAGATGGCCATCAGTGGTGGCTTCATCCGCAGGGTAACAAACGAT
  GCCCGGGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGAAACCTCCGTCATATGG
  CCCTAGACATGGGCAATGAGATTGACACCCAGAATCGCCAGATTGACAGGATCATGGAGAAGGCTGACTC
  CAACAAAACCAGAATTGATGAAGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_030991
• ORF Size: 621 bp
• Insert Size: 621
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_030991.3, NP_112253.1
• RefSeq Size: 2135
• RefSeq ORF: 621
• Locus ID: 25012
• Gene Summary: Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein. It is essential for regulated exocytosis in neuronal cells. Alternative transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (3, also known as b) has an alternate in-frame exon in the coding region, compared to variant 1. The resulting isoform (b) is of the same length, but has a distinct internal segment, compared to isoform a.