Bglap (NM_013414) Rat Untagged Clone

CAT#: RN212522

Bglap (untagged ORF) - Rat bone gamma-carboxyglutamate (gla) protein (Bglap), (10 ug)


  "NM_013414" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Bglap"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Bglap
Synonyms Bglap2; Bgp; Bgpr; Bgpra
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN212522 representing NM_013414
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGACCCTCTCTCTGCTCACTCTGCTGGCCCTGACTGCATTCTGCCTCTCTGACCTGGCAGGTGCAA
AGCCCAGCGACTCTGAGTCTGACAAAGCCTTCATGTCCAAGCAGGAGGGCAGTAAGGTGGTGAATAGACT
CCGGCGCTACCTCAACAATGGACTTGGAGCCCCAGCCCCCTACCCAGATCCCCTGGAGCCTCACAGGGAG
GTGTGTGAGCTCAACCCCAATTGTGACGAGCTAGCGGACCACATTGGCTTCCAGGACGCCTACAAGCGCA
TCTATGGCACCACCGTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013414
ORF Size 300 bp
Insert Size 300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013414.1, NP_038200.1
RefSeq Size 487
RefSeq ORF 300
Locus ID 25295
Gene Summary highly conserved protein associated with mineralized bone matrix; protein is secreted by calcified tissues and is regulated by vitamin D3 [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.