S100a1 (NM_001007636) Rat Untagged Clone
CAT#: RN212641
S100a1 (untagged ORF) - Rat S100 calcium binding protein A1 (S100a1), (10 ug)
"NM_001007636" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | S100a1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN212641 representing NM_001007636
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCTCTGAGCTGGAGACCGCCATGGAGACCCTCATCAATGTGTTCCATGCCCACTCGGGCAAGGAAG GGGACAAATATAAGCTGAGCAAGAAGGAGCTGAAAGACCTGCTACAAACTGAACTCTCCAGCTTCCTGGA TGTCCAGAAGGATGCAGATGCTGTGGACAAGATCATGAAGGAACTGGATGAGAATGGAGATGGGGAAGTG GACTTCCAGGAGTTTGTTGTGCTGGTGGCTGCTCTCACAGTGGCTTGTAACAACTTCTTCTGGGAGAACA GTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007636 |
Insert Size | 285 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007636.3, NP_001007637.1 |
RefSeq Size | 601 bp |
RefSeq ORF | 285 bp |
Locus ID | 295214 |
Cytogenetics | 2q34 |
Gene Summary | may play a role in signal transduction and myocardial function [RGD, Feb 2006] |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR212641 | S100a1 (Myc-DDK-tagged ORF) - Rat S100 calcium binding protein A1 (S100a1), (10 ug) |
USD 420.00 |
|
RR212641L3 | Lenti ORF clone of S100a1 (Myc-DDK-tagged ORF) - Rat S100 calcium binding protein A1 (S100a1), (10 ug) |
USD 640.00 |
|
RR212641L4 | Lenti ORF clone of S100a1 (mGFP-tagged ORF) - Rat S100 calcium binding protein A1 (S100a1), (10 ug) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review