Prok1 (NM_138851) Rat Untagged Clone

CAT#: RN212665

Prok1 (untagged ORF) - Rat prokineticin 1 (Prok1), (10 ug)


  "NM_138851" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Prok1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Prok1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN212665 representing NM_138851
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGAGGTGCTGTGCAAGTCTTCATCATGCTCCTTCTAGCAACTGTCTCTGACTGTGCGGTGATCACAG
GGGCCTGTGAACGAGATGTCCAGTGTGGGGCTGGCACCTGCTGTGCTATCAGCCTGTGGCTGCGGGGCCT
GAGGCTGTGTACCCCTCTGGGGCGGGAAGGAGAGGAGTGCCACCCTGGAAGCCACAAGATCCCTTTCTTT
AGGAAACGCCAACACCATACCTGTCCCTGTTCACCCAGCCTGCTGTGCTCCAGGTTCCCAGATGGCAGGT
ACCGCTGCTCCCAGGACTTGAAGAATGTCAACTTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_138851
ORF Size 318 bp
Insert Size 318
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_138851.1, NP_620206.1
RefSeq Size 318
RefSeq ORF 318
Locus ID 192205
Gene Summary may act as an endothelial cell mitogen; may be involved in G-protein coupled receptor signaling via regulation of intracellular calcium [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.