Sem1 (NM_001126090) Rat Untagged Clone

CAT#: RN212683

Shfm1 (untagged ORF) - Rat split hand/foot malformation (ectrodactyly) type 1 (Shfm1), (10 ug)


  "NM_001126090" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Sem1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Sem1
Synonyms Dss1; Shfm1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN212683 representing NM_001126090
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCGAGAAGAAGCAGCCTGTCGACTTGGGTCTCCTGGAAGAGGACGACGAGTTCGAGGAGTTTCCCG
CGGAAGACTGGGCCGGCTTAGATGAAGATGAAGATGCACATGTCTGGGAGGATAATTGGGATGATGACAA
TGTAGAAGACGACTTCTCCAATCAGTTACGCGCTGAGCTGGAGAAGCATGGTTACAAGATGGAGACTTCA
TAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001126090
ORF Size 213 bp
Insert Size 213
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001126090.1, NP_001119562.1
RefSeq Size 753
RefSeq ORF 213
Locus ID 680532

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.