Scgb2a2 (NM_203333) Rat Untagged Clone

CAT#: RN213054

Scgb2a2 (untagged ORF) - Rat secretoglobin, family 2A, member 2 (Scgb2a2), (10 ug)


  "NM_203333" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Scgb2a2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Scgb2a2
Synonyms MGC72333
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213054 representing NM_203333
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTGGTGTTTCTATTCTTGTTGGTCACCATCCCCATTTGCTGCTATGCCAGTGGTTCTGGCTGCA
GTATTCTAGATGAAGTTATTAGAGGTACAATTAACTCAACTGTGACTTTACATGACTATATGAAATTAGT
TAAGCCATATGTACAAGATCATTTTACTGAAAAGGCTGTGAAGCAATTCAAGCAGTGTTTTCTAGATCAG
ACCGACAAGACTCTGGAAAATGTTGGCGTGATGATGGAGGCAATATTTAACAGTGAAAGCTGTCAACAGC
CATCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_203333
ORF Size 288 bp
Insert Size 288
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_203333.2, NP_976078.1
RefSeq Size 1118
RefSeq ORF 288
Locus ID 361725
Gene Summary one of three polypeptides which make up prostatic steroid-binding protein, the predominant protein secreted into rat prostatic fluid [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.