Fkbp1b (NM_022675) Rat Untagged Clone

CAT#: RN213126

Fkbp1b (untagged ORF) - Rat FK506 binding protein 1b (Fkbp1b), (10 ug)


  "NM_022675" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Fkbp1b"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Fkbp1b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213126 representing NM_022675
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCGTGGAGATCGAGACCATCTCCCCGGGAGACGGAAGGACATTCCCTAAGAAGGGTCAGATATGCG
TGGTGCACTACACAGGGATGCTCCAGAATGGCAAGAAATTCGATTCGTCCAGAGACAGAAACAAACCCTT
CAAGTTCAGAATTGGCAAGCAGGAAGTCATCAAAGGTTTTGAAGAAGGCGCTGCCCAGATGAGCTTGGGG
CAGAGGGCGAAGCTGACCTGCACCCCTGATGTGGCATATGGAGCTACTGGCCACCCCGGTGTCATCCCTC
CCAATGCCACCCTCATCTTTGACGTGGAGCTGCTCAACTTAGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022675
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_022675.1, NP_073166.1
RefSeq Size 327
RefSeq ORF 327
Locus ID 58950
Gene Summary associates with the ryanodine receptor 2 (RyR2); binds cyclic ADP-ribose to effect the release of intracellular calcium, may be important for insulin secretion [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.